View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5868_high_8 (Length: 269)
Name: NF5868_high_8
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5868_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 159 - 232
Target Start/End: Original strand, 21368723 - 21368796
Alignment:
| Q |
159 |
tgcaaaattcttaagagctaacggaattacttattttaaagtacgcgaacaaacattagagatacttgggaaat |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21368723 |
tgcaaaattcttaagagctaatggaattacttatctgaaagtacgcgaacaaacattagagatacttgggaaat |
21368796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 3 - 57
Target Start/End: Complemental strand, 21442337 - 21442283
Alignment:
| Q |
3 |
gtcacacgatttgtgttttttaaagtaggaggtaggtctcccttgtgtgatcatt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21442337 |
gtcacacgatttgtgttttttaaagtaggaggtaggcctcccttgtgtgatcatt |
21442283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University