View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5868_low_14 (Length: 218)

Name: NF5868_low_14
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5868_low_14
NF5868_low_14
[»] chr3 (1 HSPs)
chr3 (13-195)||(10824910-10825092)
[»] chr6 (1 HSPs)
chr6 (111-147)||(629996-630032)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 13 - 195
Target Start/End: Complemental strand, 10825092 - 10824910
Alignment:
13 gtgagatgaagcgcagttgtgggttgctcacctgccgtaataaaatcaatnnnnnnnttgaaacataatttaatctgattgtttgtttttgctaattgac 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||| ||||||||    
10825092 gtgatatgaagcgcagttgtgggttgctcacctgccgtaataaaatcaataaaaaa-ttgaaacataatttaatctgattgtttgtttttgttaattgac 10824994  T
113 ctcccttagttattacacccccaattttggttatttgatttaatacgtcccttgcctccat-cttttttggtatttccgaattc 195  Q
    ||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| ||||||| ||||||||||||||    
10824993 ctcccttagttattacacccccagttttgtttttttgatttaatacgtcccttgcctccatcctttttttgtatttccgaattc 10824910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 147
Target Start/End: Original strand, 629996 - 630032
Alignment:
111 acctcccttagttattacacccccaattttggttatt 147  Q
    |||||||||| ||||||||||| ||||||||||||||    
629996 acctcccttaattattacaccctcaattttggttatt 630032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University