View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5868_low_14 (Length: 218)
Name: NF5868_low_14
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5868_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 13 - 195
Target Start/End: Complemental strand, 10825092 - 10824910
Alignment:
| Q |
13 |
gtgagatgaagcgcagttgtgggttgctcacctgccgtaataaaatcaatnnnnnnnttgaaacataatttaatctgattgtttgtttttgctaattgac |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10825092 |
gtgatatgaagcgcagttgtgggttgctcacctgccgtaataaaatcaataaaaaa-ttgaaacataatttaatctgattgtttgtttttgttaattgac |
10824994 |
T |
|
| Q |
113 |
ctcccttagttattacacccccaattttggttatttgatttaatacgtcccttgcctccat-cttttttggtatttccgaattc |
195 |
Q |
| |
|
||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
10824993 |
ctcccttagttattacacccccagttttgtttttttgatttaatacgtcccttgcctccatcctttttttgtatttccgaattc |
10824910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 147
Target Start/End: Original strand, 629996 - 630032
Alignment:
| Q |
111 |
acctcccttagttattacacccccaattttggttatt |
147 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
629996 |
acctcccttaattattacaccctcaattttggttatt |
630032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University