View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5868_low_8 (Length: 269)

Name: NF5868_low_8
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5868_low_8
NF5868_low_8
[»] chr6 (2 HSPs)
chr6 (159-232)||(21368723-21368796)
chr6 (3-57)||(21442283-21442337)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 159 - 232
Target Start/End: Original strand, 21368723 - 21368796
Alignment:
159 tgcaaaattcttaagagctaacggaattacttattttaaagtacgcgaacaaacattagagatacttgggaaat 232  Q
    ||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||    
21368723 tgcaaaattcttaagagctaatggaattacttatctgaaagtacgcgaacaaacattagagatacttgggaaat 21368796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 3 - 57
Target Start/End: Complemental strand, 21442337 - 21442283
Alignment:
3 gtcacacgatttgtgttttttaaagtaggaggtaggtctcccttgtgtgatcatt 57  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
21442337 gtcacacgatttgtgttttttaaagtaggaggtaggcctcccttgtgtgatcatt 21442283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University