View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5870-Insertion-5 (Length: 268)
Name: NF5870-Insertion-5
Description: NF5870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5870-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 9 - 174
Target Start/End: Complemental strand, 42069607 - 42069441
Alignment:
| Q |
9 |
ggaattggttttaattttgtagtaaaacaatatgctcgggacaatctcaacggttacattttctgaatccgtttgattgga-gtcataaaagtacttatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42069607 |
ggaattggttttaattttgtagtaaaacaaaatgctcgggacaatctcaacggttacattttctgaatccgtttgattggaggtcataaaagtacttatg |
42069508 |
T |
|
| Q |
108 |
tacttaccatacagtgcatccatgtataaactaggcccatgtcctttgcattttatttttctttcag |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
42069507 |
tacttaccatacagtgcatccatgtataaactaggcctatgtcctttacattttatttttctttcag |
42069441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University