View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5870_high_4 (Length: 272)
Name: NF5870_high_4
Description: NF5870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5870_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 88 - 253
Target Start/End: Original strand, 42069441 - 42069607
Alignment:
| Q |
88 |
ctgaaagaaaaataaaatgcaaaggacatgggcctagtttatacatggatgcactgtatggtaagtacataagtacttttatgac-tccaatcaaacgga |
186 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42069441 |
ctgaaagaaaaataaaatgtaaaggacataggcctagtttatacatggatgcactgtatggtaagtacataagtacttttatgacctccaatcaaacgga |
42069540 |
T |
|
| Q |
187 |
ttcagaaaatgtaaccgttgagattgtcccgagcatattgttttactacaaaattaaaaccaattcc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42069541 |
ttcagaaaatgtaaccgttgagattgtcccgagcattttgttttactacaaaattaaaaccaattcc |
42069607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University