View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5870_low_3 (Length: 303)
Name: NF5870_low_3
Description: NF5870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5870_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 156 - 287
Target Start/End: Complemental strand, 43799409 - 43799272
Alignment:
| Q |
156 |
cactgaccgcattgatggtcataaggaagtaatggaaggaataatagatgtagaagtaattgcaatatacatagatacgcac------attagtttgatt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
43799409 |
cactgaccgcattgatggtcataaggaagtaatggaaggaataatagatgtagaagtaattgcaatatacatagatacacacttaaatattagtttgatt |
43799310 |
T |
 |
| Q |
250 |
cttctattcaataggtttgatggttttgacatcattct |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43799309 |
cttctattcaataggtttgatggttttgacatcattct |
43799272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 20 - 100
Target Start/End: Complemental strand, 49766494 - 49766414
Alignment:
| Q |
20 |
aatactactgcttcagctaagcttaaggaaaagtgttgttcaggttcttctttaggaagaaagaacgacattgttattgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766494 |
aatactactgcttcagctaagcttaaggaaaagtgttgttcaggttcttctttaggaagaaagaacgacattgttattgtt |
49766414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 118 - 148
Target Start/End: Complemental strand, 49766396 - 49766366
Alignment:
| Q |
118 |
taacagtcctaatagcaacaacacaggttct |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49766396 |
taacagtcctaatagcaacaacacaggttct |
49766366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University