View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871-Insertion-12 (Length: 237)
Name: NF5871-Insertion-12
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871-Insertion-12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 26050131 - 26049901
Alignment:
| Q |
8 |
atgtacaagctattgtgcagcattcaaatctaccatacatcaaaagatttgcatgagaaatatccaccaatttatcagcacgggtttgaattctccctgg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26050131 |
atgtacaagctattgtgcagcattcaaatctaccatacatcaaacgatttgcatgagaaatatccatcaatttatcagcacgggtttgaattctccctgg |
26050032 |
T |
 |
| Q |
108 |
ttgtcg-aatatagaatcagaacccaccaatgcagcaaaagtcatgtcaagtgttaaaaccagaagattcaaatccatatcaaattagcaacaccttatc |
206 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26050031 |
ttgtcggaatataggatcagaacccaccaatgcagcaaaagtcatgtccagtgttaaaaccagaagattcaaatccatatcaaattagcaacaccttatc |
26049932 |
T |
 |
| Q |
207 |
aagaagtgcaattgccaactcgtcgtacctg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26049931 |
aagaagtgcaattgccaactcgtcgtacctg |
26049901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University