View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5871-Insertion-7 (Length: 601)

Name: NF5871-Insertion-7
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5871-Insertion-7
NF5871-Insertion-7
[»] chr3 (9 HSPs)
chr3 (192-269)||(816529-816606)
chr3 (58-127)||(816671-816740)
chr3 (345-405)||(816393-816453)
chr3 (482-519)||(816279-816316)
chr3 (61-125)||(816388-816450)
chr3 (10-43)||(816757-816790)
chr3 (88-125)||(816821-816858)
chr3 (348-405)||(816678-816737)
chr3 (69-127)||(816079-816143)


Alignment Details
Target: chr3 (Bit Score: 74; Significance: 1e-33; HSPs: 9)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 192 - 269
Target Start/End: Complemental strand, 816606 - 816529
Alignment:
Q  192 taaaattgtatggattgtggtttgattaatcggttctctgcctaattgtggttttcttatgagcttgatttttaatta 269  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  816606 taaaattgtatggattgtggtttgattaattggttctctgcctaattgtggttttcttatgagcttgatttttaatta 816529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 58 - 127
Target Start/End: Complemental strand, 816740 - 816671
Alignment:
Q  58 gtaaaattgtatatgaattgtggtttgattaattgggtttttgcttaattgtggtttcttatgaacttat 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  816740 gtaaaattgtatatgaattgtggtttgattaattgggtttttgcttaattgtggtttcttatgaacttat 816671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 345 - 405
Target Start/End: Complemental strand, 816453 - 816393
Alignment:
Q  345 gtgaaattgtatatattatggttcgattaattgggtctttgcttagttgtggtttcttatg 405  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  816453 gtgaaattgtatatattatggttcgattaattgggtctttgcttagttgtggtttcttatg 816393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 482 - 519
Target Start/End: Complemental strand, 816316 - 816279
Alignment:
Q  482 aatagggtctttcctttgctttgttgcggcttcttatc 519  Q
    ||||||||||||||||||||||||||||||||||||||    
T  816316 aatagggtctttcctttgctttgttgcggcttcttatc 816279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 61 - 125
Target Start/End: Complemental strand, 816450 - 816388
Alignment:
Q  61 aaattgtatatgaattgtggtttgattaattgggtttttgcttaattgtggtttcttatgaactt 125  Q
    |||||||||||  ||| ||||| |||||||||||| |||||||| ||||||||||||||||||||    
T  816450 aaattgtatat--attatggttcgattaattgggtctttgcttagttgtggtttcttatgaactt 816388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 10 - 43
Target Start/End: Complemental strand, 816790 - 816757
Alignment:
Q  10 tatgctcaattttcgttttcatttcttgctttga 43  Q
    ||||||||||||||||||||||||||||||||||    
T  816790 tatgctcaattttcgttttcatttcttgctttga 816757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 88 - 125
Target Start/End: Complemental strand, 816858 - 816821
Alignment:
Q  88 aattgggtttttgcttaattgtggtttcttatgaactt 125  Q
    ||||||||||||||||||||||||||| ||||||||||    
T  816858 aattgggtttttgcttaattgtggttttttatgaactt 816821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 816737 - 816678
Alignment:
Q  348 aaattgtatat--attatggttcgattaattgggtctttgcttagttgtggtttcttatg 405  Q
    |||||||||||  ||| ||||| |||||||||||| |||||||| |||||||||||||||    
T  816737 aaattgtatatgaattgtggtttgattaattgggtttttgcttaattgtggtttcttatg 816678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 69 - 127
Target Start/End: Complemental strand, 816143 - 816079
Alignment:
Q  69 tatgaattgtggtttgattaattgggttttt------gcttaattgtggtttcttatgaacttat 127  Q
    |||||||| ||||||||| ||||||||||||      ||||||||| ||||||||||||||||||    
T  816143 tatgaattttggtttgatgaattgggtttttttttttgcttaattgcggtttcttatgaacttat 816079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University