View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_high_11 (Length: 486)
Name: NF5871_high_11
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 443; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 9 - 467
Target Start/End: Complemental strand, 46847649 - 46847191
Alignment:
| Q |
9 |
agcagagattcttatgaaaaatatggaaatggagccggatggagctatttggggttctcttcttagtgcttgtaaggttcatggacgcgttgagttcggt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46847649 |
agcagagattcttatgaaaaatatggaaatggagccggatggagctatttggggttctcttcttagtgcttgtaaggctcatggacgcgttgagttcggt |
46847550 |
T |
|
| Q |
109 |
gaatatgtagcagaacgcctctttcaattagagccagaaaatgcaggggcatttgtgcttctgtcaaatatatatgcaggagctggtagatgggacgatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46847549 |
gaatatgtagcagaacgcctctttcaattagagccagaaaatgcaggggcatttgtgcttctgtcaaatatatatgcaggagctggtagatgggacgatg |
46847450 |
T |
|
| Q |
209 |
tagcaaggataagaacaaggttaaatgacaaaggaatgaagaaagttcccggttgcacctctatagagattgatggtgatgttcatgaattccttgtcgg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46847449 |
tagcaaggataagaacaaggttaaatgacaaaggaatgaagaaagttcccggttgcacctctatagagattgatggtgatgttcatgagttccttgtcgg |
46847350 |
T |
|
| Q |
309 |
tgataagttccacccggaatgcaacaatatttataaaatgttgaatgaggtagataagcttttggaggaaaatggatttgtgcccgatacttctgaggta |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46847349 |
tgataagttccacccggaatgcaacaatatttataaaatgttgaacgaggtagataagcttttggaggaaaatggatttgtgcccaatacttctgaggta |
46847250 |
T |
|
| Q |
409 |
ctttatgatatggatgaagagtggaaggaaggggctttgagtcaacacagtgagaagct |
467 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46847249 |
ctttatgatatggatgaagagtggaaggaaggggctttgagtcaacacagtgagaagct |
46847191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University