View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5871_high_16 (Length: 341)

Name: NF5871_high_16
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5871_high_16
NF5871_high_16
[»] chr3 (3 HSPs)
chr3 (1-129)||(816393-816521)
chr3 (206-243)||(816279-816316)
chr3 (72-129)||(816678-816737)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 816521 - 816393
Alignment:
1 tttaaaagttttgatttttatgcttgttcttctcaattttcatatcttgctttgannnnnnnnnnnnngtgaaattgtatatattatggttcgattaatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||             ||||||||||||||||||||||||||||||||    
816521 tttaaaagttttgatttttatgcttgttcttctcaattttcatatcttgctttgatttttttgtttttgtgaaattgtatatattatggttcgattaatt 816422  T
101 gggtctttgcttagttgtggtttcttatg 129  Q
    |||||||||||||||||||||||||||||    
816421 gggtctttgcttagttgtggtttcttatg 816393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 243
Target Start/End: Complemental strand, 816316 - 816279
Alignment:
206 aatagggtctttcctttgctttgttgcggcttcttatc 243  Q
    ||||||||||||||||||||||||||||||||||||||    
816316 aatagggtctttcctttgctttgttgcggcttcttatc 816279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 129
Target Start/End: Complemental strand, 816737 - 816678
Alignment:
72 aaattgtatat--attatggttcgattaattgggtctttgcttagttgtggtttcttatg 129  Q
    |||||||||||  ||| ||||| |||||||||||| |||||||| |||||||||||||||    
816737 aaattgtatatgaattgtggtttgattaattgggtttttgcttaattgtggtttcttatg 816678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University