View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5871_high_25 (Length: 256)

Name: NF5871_high_25
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5871_high_25
NF5871_high_25
[»] chr3 (1 HSPs)
chr3 (19-230)||(29474899-29475110)


Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 29475110 - 29474899
Alignment:
19 gagacgaaggaaacgacacggtcagcggacacaagacgacgatggaagttgaagagaggaattagggatttggagaaagcggagaagaaatgagaagggg 118  Q
    |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29475110 gagacgaaggaaacgacacggtcagcggaagcaagacgacgatggaagttgaagagaggaattagggatttggagaaagcggagaagaaatgagaagggg 29475011  T
119 aagtggatttggatcggaggagagagagttctttgagtttgcggttgtgtgttgcgtatgagattcgaacttcgtcgaggatggaagcgattttttggga 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
29475010 aagtggatttggatcggaggagagagagttctttgagtttgcggttgtgtgttgcgtatgagattcgaatttcgtcgaggatggaagcgattttttggga 29474911  T
219 taagcgattttc 230  Q
    ||||||||||||    
29474910 taagcgattttc 29474899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University