View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_high_28 (Length: 252)
Name: NF5871_high_28
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_high_28 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 12 - 252
Target Start/End: Complemental strand, 35720058 - 35719816
Alignment:
| Q |
12 |
attatactctctaattatgtcatgtgattagatgtatccaagttggcttagggatatatatat--ctatgtgatgcatgcatgtgttacatttcaaagtc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35720058 |
attatactctctaattatgtcatgtgattggatgtatccaacttggcttagggatatatatatatctatgtgatgcatgcatgtgttacatttcaaagtc |
35719959 |
T |
 |
| Q |
110 |
tgtggatgcgtgtgatttttgctctattatatacgcacccataaatatattggctagagcttatatatgtgggatgtggtcctcatatagaacatagagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35719958 |
tgtggatgcgtgtgatttttgctctattatatacgcacccataaatatattggctagagcttatatatgtgggatgtggtcctcatatagaacatagagg |
35719859 |
T |
 |
| Q |
210 |
gtgattaattgaagctctagcaattattttgattagtgaagga |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35719858 |
gtgattaattgaagctctagcaattattttgattagtgaagga |
35719816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University