View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_high_30 (Length: 250)
Name: NF5871_high_30
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_high_30 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 41587920 - 41588156
Alignment:
| Q |
11 |
cacagagacactatcgagtaaaccggtacgaaagagctccttcattgttgtaggccgcttcttatcaactgcaatcttcttcgacatcttcaactccatc |
110 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41587920 |
cacagagacaccatcgagtaaaccggtacgaaagagctccttcattgttgtaggccgcttcttatcaactgcaatcttcttcgacgtcttcaactccatc |
41588019 |
T |
|
| Q |
111 |
ttgtttctccgaacagctaatgcaccatcaatttcactctcaacagcagcagcacctttttggtctaacttcgtcactgtctcctcaccggacccagcat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41588020 |
ttgtttctccgaacagctaatgcaccatcaatttcactctcaa---cagcagcaccttcttggtctaacttcgtcactgtctcctcaccggacccagcat |
41588116 |
T |
|
| Q |
211 |
ttgctttcatagtcgcagaccgtgtagtccgcttgaatgt |
250 |
Q |
| |
|
||||||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
41588117 |
ttgctttcatagttgcagaccgcatagtccgattgaatgt |
41588156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University