View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_high_31 (Length: 249)
Name: NF5871_high_31
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 6839706 - 6839942
Alignment:
| Q |
1 |
aaaagaatgcgcaaaccgcaaattatcaagaaaatgtatttagaatgacagttttagcacaaattacaggtcgtgtgttgtgattgattatagaggatat |
100 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6839706 |
aaaagaatgcgcaa-ctgcaaattatcaagaaaatgtatttagaatgacagtttcagcacaaattacaggtcgtgtgttgtgattgattatagaggatat |
6839804 |
T |
 |
| Q |
101 |
tgtgacaagcaaggatggattgttcttgcgtatgtaatgataattatgacagtattacaacataatggataaaaaattgttgataaaaattacaagtttc |
200 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
6839805 |
tgtgacaggcaaggatggattgttcttgtgtatgtaatgataattatgacagtattacaacataatggataaaaaattgttgaatttttttttaagtttc |
6839904 |
T |
 |
| Q |
201 |
atgatctattaaacctgtcctccaatgcattgatccct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6839905 |
atgatctattaaacctgtcctccaatgcatcgatccct |
6839942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University