View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_high_32 (Length: 244)
Name: NF5871_high_32
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 26050129 - 26049895
Alignment:
| Q |
1 |
gtacaagctattgtgcagcattcaaatctaccatacatcaaaagatttgcatgagaaatatccaccaatttatcagcacgggtttgaattctccctggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26050129 |
gtacaagctattgtgcagcattcaaatctaccatacatcaaacgatttgcatgagaaatatccatcaatttatcagcacgggtttgaattctccctggtt |
26050030 |
T |
|
| Q |
101 |
gtcg-aatatagaatcagaacccaccaatgcagcaaaagtcatgtcaagtgttaaaaccagaagattcaaatccatatcaaattagcaacaccttatcaa |
199 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26050029 |
gtcggaatataggatcagaacccaccaatgcagcaaaagtcatgtccagtgttaaaaccagaagattcaaatccatatcaaattagcaacaccttatcaa |
26049930 |
T |
|
| Q |
200 |
gaagtgcaattgccaactcgtcgtacctgcctttg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26049929 |
gaagtgcaattgccaactcgtcgtacctgcctttg |
26049895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University