View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_high_37 (Length: 231)
Name: NF5871_high_37
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 121 - 213
Target Start/End: Original strand, 23827370 - 23827462
Alignment:
| Q |
121 |
gagtttcaattcacaatcatgagtcatttcttttggagttgaccttctctgctttgttgttgtgatctacaggcaacaaagttatgggaatta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23827370 |
gagtttcaattcacaatcatgagtcatttcttttggagttgaccttctctgctttgttgttgtgatctacaggcaacaaagttatgggaatta |
23827462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 135 - 213
Target Start/End: Original strand, 23823522 - 23823600
Alignment:
| Q |
135 |
aatcatgagtcatttcttttggagttgaccttctctgctttgttgttgtgatctacaggcaacaaagttatgggaatta |
213 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||| |||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23823522 |
aatcatggttcatttctgttggatatgaccttctctactttgttgttgtgatctataggcaacaaagctatgggaatta |
23823600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 23827249 - 23827294
Alignment:
| Q |
1 |
cttgctttttctcttgtctatatccttccttgaacttcattactaa |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23827249 |
cttgctttttctcttgtctatatccttccttgaacttcattactaa |
23827294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University