View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_high_38 (Length: 230)
Name: NF5871_high_38
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 38584217 - 38584431
Alignment:
| Q |
1 |
ttgatatttttcatgatgctgctgtttctgaactcagaaacattggtgttttggattggtcaaatatttcagtagtttttgttgtgtgtgttttgcactt |
100 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584217 |
ttgatattttccatgatgctgttgtttctgaactaagaaacattggtgttttggattggtcaaatatttcagtagtttttgttgtgtgtgttttgcactt |
38584316 |
T |
 |
| Q |
101 |
gtgctggctctggctgttacattaataatatcctaggtggaaagtggtttgaactttttactacaacaaaacaaccacactgttgactggtcatttagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584317 |
gtgctggctctggctgttacattaataatatcctaggtggaaagtggtttgaactttttactacaacaaaacaaccacactgttgactggtcatttagta |
38584416 |
T |
 |
| Q |
201 |
aaattgctagcttct |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38584417 |
aaattgctagcttct |
38584431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University