View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_low_17 (Length: 341)
Name: NF5871_low_17
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 816521 - 816393
Alignment:
| Q |
1 |
tttaaaagttttgatttttatgcttgttcttctcaattttcatatcttgctttgannnnnnnnnnnnngtgaaattgtatatattatggttcgattaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
816521 |
tttaaaagttttgatttttatgcttgttcttctcaattttcatatcttgctttgatttttttgtttttgtgaaattgtatatattatggttcgattaatt |
816422 |
T |
 |
| Q |
101 |
gggtctttgcttagttgtggtttcttatg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
816421 |
gggtctttgcttagttgtggtttcttatg |
816393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 243
Target Start/End: Complemental strand, 816316 - 816279
Alignment:
| Q |
206 |
aatagggtctttcctttgctttgttgcggcttcttatc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
816316 |
aatagggtctttcctttgctttgttgcggcttcttatc |
816279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 129
Target Start/End: Complemental strand, 816737 - 816678
Alignment:
| Q |
72 |
aaattgtatat--attatggttcgattaattgggtctttgcttagttgtggtttcttatg |
129 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
816737 |
aaattgtatatgaattgtggtttgattaattgggtttttgcttaattgtggtttcttatg |
816678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University