View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_low_23 (Length: 274)
Name: NF5871_low_23
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_low_23 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 45 - 274
Target Start/End: Complemental strand, 33782269 - 33782044
Alignment:
| Q |
45 |
agtggttgttgtctacctaaattggtccaaagaccaaattgagtttttattcaagaaactatatgttnnnnnnntaaatgcaattatgaatggtggcaaa |
144 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33782269 |
agtggttgttgtctacctaaatttgtccaaagaccaaattgagtttttattcaagaaactatatgttaaaaaaataaatgcaattatgaatggtggcaaa |
33782170 |
T |
|
| Q |
145 |
tggtgtggggtgtttgtgcaaatggtgcgcgcacacacnnnnnnnnnnnnnnnnnagcaaagaaacacaacacaacgccattcactagtttgtgtttgta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33782169 |
tggtgtggggtgtttgtgcaaatggtgcacacacacac----atatatatatataagcaaagaaacacaacacaacgccattcactagtttgtgtttgta |
33782074 |
T |
|
| Q |
245 |
attcaaagtggtttttaaggtcctcttttt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33782073 |
attcaaagtggtttttaaggtcctcttttt |
33782044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University