View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_low_26 (Length: 256)
Name: NF5871_low_26
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 29475110 - 29474899
Alignment:
| Q |
19 |
gagacgaaggaaacgacacggtcagcggacacaagacgacgatggaagttgaagagaggaattagggatttggagaaagcggagaagaaatgagaagggg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29475110 |
gagacgaaggaaacgacacggtcagcggaagcaagacgacgatggaagttgaagagaggaattagggatttggagaaagcggagaagaaatgagaagggg |
29475011 |
T |
|
| Q |
119 |
aagtggatttggatcggaggagagagagttctttgagtttgcggttgtgtgttgcgtatgagattcgaacttcgtcgaggatggaagcgattttttggga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29475010 |
aagtggatttggatcggaggagagagagttctttgagtttgcggttgtgtgttgcgtatgagattcgaatttcgtcgaggatggaagcgattttttggga |
29474911 |
T |
|
| Q |
219 |
taagcgattttc |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29474910 |
taagcgattttc |
29474899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University