View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_low_30 (Length: 250)
Name: NF5871_low_30
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 42 - 123
Target Start/End: Original strand, 35037638 - 35037719
Alignment:
| Q |
42 |
tagtaacgtacaatgtatttctacatattttgttcttattagttatgttgatacttaatacataatttattcctctagttgc |
123 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037638 |
tagtaacgtacaatgtatttttacatattttgttcttattagttatgttgatacttaatacataatttattcctctagttgc |
35037719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 185 - 235
Target Start/End: Original strand, 35037716 - 35037766
Alignment:
| Q |
185 |
ttgcagggtcaaatgggatgaatgatctctactcctccagccagtccatta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037716 |
ttgcagggtcaaatgggatgaatgatctctactcctccagccagtccatta |
35037766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 35037534 - 35037576
Alignment:
| Q |
1 |
aatcttatccacagcatccaggtgaaccagattgttcatatta |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037534 |
aatcttatccacagcatccaggtgaaccagattgttcatatta |
35037576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University