View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5871_low_36 (Length: 233)
Name: NF5871_low_36
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5871_low_36 |
 | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 214
Target Start/End: Original strand, 11405551 - 11405748
Alignment:
| Q |
19 |
attaccatggaagctatcaaaactttacttcaaaaagacccccttcattatttctcagtagtgaagattgcatagcaggtttactcactacnnnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11405551 |
attaccatggaagctatcaaaactttacttcaaaaatacccccttcattatttctcagtagtgaagattgcagagcaggtttactcactacttttttttt |
11405650 |
T |
|
| Q |
119 |
--ctaatactcatttgtcttatgttttcattcttaactaacatgaacattaattgtttttatactttttatcttttctttgtttagatgcatcatgag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11405651 |
ttctaatactcatttgtcttatgttttcattcttaactaacatgaacattaattgtttttatactttttatcttttctttgtttagatgcatcatgag |
11405748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 17024731 - 17024899
Alignment:
| Q |
19 |
attaccatggaagctatcaaaactttacttcaaaaagacccccttcattatttctcagtagtgaagattgcatagcaggtttactcactacnnnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| | || ||||||||||| | | |
|
|
| T |
17024731 |
attaccatggaagctatcaaaactttacttaaaaaagacccccttgattatttctcagtagtgaagattgtagagaaggtttactcaatgcttttttttt |
17024830 |
T |
|
| Q |
119 |
ctaatactcatttgtcttatgttttcattcttaactaacatgaacattaattgtttttatactttttat |
187 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
17024831 |
gtaatactgattttaattatgttttcattcttaactaacatcaacattaattgtttttatactatttat |
17024899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 23569298 - 23569214
Alignment:
| Q |
16 |
aatattaccatggaagctatcaaaactttacttcaaaaagacccccttcattatttctcagtagtgaagattgcatagcaggttt |
100 |
Q |
| |
|
||||| |||||||||| | |||||||||| ||||||||||||||| |||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
23569298 |
aatatcaccatggaaggtttcaaaactttgcttcaaaaagaccccactcattatttctcggtggtgaagattgcagagcaggttt |
23569214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 135 - 214
Target Start/End: Complemental strand, 115243 - 115167
Alignment:
| Q |
135 |
ttatgttttcattcttaactaacatgaacattaattgtttttatactttttatcttttctttgtttagatgcatcatgag |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||| | |||||||||||||| |||| |
|
|
| T |
115243 |
ttatgttttcattcttaactaacatcaacattaattgtttttatactattt---ttttttctgtttagatgcatcctgag |
115167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 115290 - 115240
Alignment:
| Q |
19 |
attaccatggaagctatcaaaactttacttcaaaaagacccccttcattat |
69 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
115290 |
attaccagagaagctatcaaaactttacttcaaaaagacccacttgattat |
115240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University