View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5872-Insertion-5 (Length: 373)
Name: NF5872-Insertion-5
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5872-Insertion-5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 9 - 373
Target Start/End: Complemental strand, 18021996 - 18021632
Alignment:
| Q |
9 |
taaattgcacttatagtggaaatggcagtgatccagtggttgtttcgcttaatttgagttcgatgaatctttctggaaccctaaatgctagcattggagg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18021996 |
taaattgcacttatagtggaaatggcagtgatccagtgattgtttcgcttaatttgagttcgatgaatctttctggaaccctaaatgctagcattggagg |
18021897 |
T |
|
| Q |
109 |
tctaaccaatttaacttatctcaatcttgcttacaatggtttgaatggaagtatccctaaggagattggtgactgtttgagtttggaatatctttactta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18021896 |
tctaaccaatttaacttatctcaatcttgcttacaatggtttgaatggaagtatccctaaggagattggtgagtgtttgagtttggaatatctttactta |
18021797 |
T |
|
| Q |
209 |
aacaataatcaatttgaaggatcaattcctgttgaattagggaaactttctgctttgaggtatttgaatatttgcaacaatatactcgctggtgttcttc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18021796 |
aacaataatcaatttgaaggatcaattcctgttgaattagggaaactttctgccttgagatatttgaatatttgcaacaatatactcgctggtgttcttc |
18021697 |
T |
|
| Q |
309 |
cggacgagattggaaagttgacttcattggttgagttggttgcttttagtaactatctcattggc |
373 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18021696 |
cggacgagattggaaagttggcttcattggttgagttggttgcttttagtaactatctcattggc |
18021632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University