View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5872-Insertion-7 (Length: 256)
Name: NF5872-Insertion-7
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5872-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 124 - 256
Target Start/End: Complemental strand, 41250174 - 41250042
Alignment:
| Q |
124 |
aaggaaggacaatgtaaaatgatgttaaattctatgggatctttttagtatttccctttatttttactgataattactcatcttttgtttatggatgatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41250174 |
aaggaaggacaatgtaaaatgatgttaaattctatgggatctttttagtattttccattattttcactgataattactcatcttttgtttatggatgatt |
41250075 |
T |
|
| Q |
224 |
gttttctattttgtagggtgtctctccaagcta |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41250074 |
gttttctattttgtagggtgtctctccaagcta |
41250042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University