View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5872_low_10 (Length: 239)
Name: NF5872_low_10
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5872_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 215777 - 215555
Alignment:
| Q |
1 |
ctactgcaccatactctaatcctagaactacaaagtccgtcnnnnnnngcaatgctgatagggtacaaagctccacatggaacagcaaaattttgggatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
215777 |
ctactgcaccatactctaatcctagaactacaaagtccgtctttttttgcaatgctgatagggtacaaagctccacttggaacagcaaaattttgggatt |
215678 |
T |
 |
| Q |
101 |
gtagagaagggtatgaagaagaaagtaaagaagaagggagtttcaaagagataagctgttttccaattggatttgatggtgcataagataattttggaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
215677 |
gtagagaagggtatgaagaagaaagtaaagaag---ggagtttcaaagagataagctgttttccaattggatttgatggtgcataagataattttggaga |
215581 |
T |
 |
| Q |
201 |
aaacccggaaacaatatgttgaattt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
215580 |
aaacccggaaacaatatgttgaattt |
215555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 45499570 - 45499490
Alignment:
| Q |
49 |
gcaatgctgatagggtacaaagctccacatggaacagcaaaattttgggattgtagagaagggtatgaagaagaaagtaaa |
129 |
Q |
| |
|
|||||| ||||||||||||| |||| || ||||| | |||||||||||||| | ||||||||| || |||||||||||| |
|
|
| T |
45499570 |
gcaatgttgatagggtacaatgctcgactcggaacctcgaaattttgggattgaatagaagggtacgatgaagaaagtaaa |
45499490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University