View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5872_low_2 (Length: 388)
Name: NF5872_low_2
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5872_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 20 - 332
Target Start/End: Original strand, 27773156 - 27773457
Alignment:
| Q |
20 |
ccaaggagccgtatcataacgagaatctatcccccaagttattggtaaagagaacaagtgacacacctattgggaaaatagggtaatgcattttaaggtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27773156 |
ccaaggagccgtatcataacgagaatctatcccccaa-----------agagaacaagtgacacacctattaggaaaatagggtaatgcattttaaggtg |
27773244 |
T |
|
| Q |
120 |
catgcataggcatgattctagcagacttcttacgggagctgcaagtagcaactctgatagaagcttcagagctaaannnnnnnatggagtttagtccatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27773245 |
catgcataggcatgattctagcagacttcttatgggagctgcaagtagcaactctaatagaagcttcagagctaaaaaattttatggagtttagtccatg |
27773344 |
T |
|
| Q |
220 |
ttgccttcttactgtagtttgaattcctgtgatttcatttcttacaggttttcaagagtgggacgcttttcttatcttccaaaggtgtgtttaactactc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27773345 |
ttgccttcttactgtagtttgaattcctgtgatttcatttcttacaggttttcaagtgtgggacgcttttcttatcttccaaaggtgtgtttaactactc |
27773444 |
T |
|
| Q |
320 |
tagtttacacatt |
332 |
Q |
| |
|
||||||||||||| |
|
|
| T |
27773445 |
tagtttacacatt |
27773457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University