View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5872_low_9 (Length: 246)
Name: NF5872_low_9
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5872_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 11773803 - 11774013
Alignment:
| Q |
14 |
aagaacaaaggtaaacattgttagctcataaacttcttgtttatcaatttcttatttttt-gcatgtgttcttttagnnnnnnnngtttgaaagtttgat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
11773803 |
aagaacaaaggtaaacattgttagctcataaacttcttgtttatcaatttcttatttttttgcatgtgttcttttagttttttttgtttgaaagtttgat |
11773902 |
T |
 |
| Q |
113 |
tgcaatttcacaattttatgataattcaatatttcacacccttttccacattcacaaattttggagcattcaagtttattttagttgcaagattggtttt |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11773903 |
tgcaatttcacaatttcatgataattcaatatttcacacccttttccacattcacaaattttggagcattcaagtttattttagttgcaagattggtttt |
11774002 |
T |
 |
| Q |
213 |
tcactctatag |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
11774003 |
tcactctatag |
11774013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University