View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5873-Insertion-10 (Length: 111)
Name: NF5873-Insertion-10
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5873-Insertion-10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 9 - 111
Target Start/End: Complemental strand, 38966683 - 38966581
Alignment:
| Q |
9 |
ctaagtgctgcggcagtgtctgtggtaaagaatggatttccagtgccggcagcaaaaatgacaacccttcctttctccaaatgcctcacagcccttccgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38966683 |
ctaagtgctgcggcagtgtctgtggtaaagaatggatttccagtgccggcagcaaaaatgacaacccttcctttctccaaatgcctcacagcccttctgc |
38966584 |
T |
 |
| Q |
109 |
gta |
111 |
Q |
| |
|
||| |
|
|
| T |
38966583 |
gta |
38966581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University