View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5873-Insertion-9 (Length: 142)
Name: NF5873-Insertion-9
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5873-Insertion-9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 6e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 6e-69
Query Start/End: Original strand, 7 - 142
Target Start/End: Original strand, 26849173 - 26849308
Alignment:
| Q |
7 |
cagttgatttaccacgaccctttttggaagcaaactcatttgtagacaaagtgaatcctggtggtgttgttagtattggtgttgttgttttaacaatctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26849173 |
cagttgatttaccacgaccctttttggaagcaaactcatttgtagacaaagtgaatcctggtggtgatgttagtattggtgttgttgttttaacaatctt |
26849272 |
T |
 |
| Q |
107 |
cttgtaacttggatttaggtttccatcagcatcata |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26849273 |
cttgtaacttggatttaggtttccatcagcatcata |
26849308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University