View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5873_high_10 (Length: 319)
Name: NF5873_high_10
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5873_high_10 |
 |  |
|
| [»] scaffold0590 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0654 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 10)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 291
Target Start/End: Complemental strand, 43163606 - 43163329
Alignment:
| Q |
16 |
tttattacatttccacaagatgtttttaacttttaccataagatctttatagcttnnnnnnnc--aacatataactaataagatctttattatagctttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43163606 |
tttattacatttccacaagatgtttttaacttttaccataagatctttatagcttaaaaaaaactaacatataactaataagatctttattatagctttt |
43163507 |
T |
 |
| Q |
114 |
gttatagaaatagattatacatagcacttatatgataagcgtttattgcttattaagcattttatccaagaaggccttatnnnnnnnncnnnnnnnnctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43163506 |
gttatagaaatagattatacatagcacttatatgataagcgtttattgcttattaagcattttatccaagaaggccttataaaaaataactttttttttc |
43163407 |
T |
 |
| Q |
214 |
cttttaggagtggttccaattctaacttccatggaatgacttgttatagttatactataagtgagatggctcacctga |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43163406 |
cttttaggagtggttccaattctaacttccatggaatgacttgttatagttatactataagtgagatggctcacctga |
43163329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 98 - 159
Target Start/End: Original strand, 33197331 - 33197393
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacata-gcacttatatgataagcgtttat |
159 |
Q |
| |
|
||||||| || |||||||||||||||||| ||||| ||| ||||||||||||||||||||||| |
|
|
| T |
33197331 |
ctttattctatcttttgttatagaaatagcttatagataagcacttatatgataagcgtttat |
33197393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 111 - 151
Target Start/End: Original strand, 33267621 - 33267662
Alignment:
| Q |
111 |
tttgttatagaaatagattatacat-agcacttatatgataa |
151 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33267621 |
tttgttatagaaatagattatacataagcacttatatgataa |
33267662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 32694189 - 32694134
Alignment:
| Q |
99 |
tttattatagcttttgttatagaaatagattatacatagcacttatatgataagcg |
154 |
Q |
| |
|
|||||| || |||||| ||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
32694189 |
tttattttatcttttgatatagaaatagcttatacataatacttatatgataagcg |
32694134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 151
Target Start/End: Original strand, 33087701 - 33087743
Alignment:
| Q |
109 |
cttttgttatagaaatagattatacatagcacttatatgataa |
151 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
33087701 |
cttttgttatagaaatagcttatatataacacttatatgataa |
33087743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 11393459 - 11393512
Alignment:
| Q |
99 |
tttattatagcttttgttatagaaatagattatacat-agcacttatatgataa |
151 |
Q |
| |
|
||||||||| |||||| ||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
11393459 |
tttattatatcttttgatatagaaatagcttatagataagcacttatatgataa |
11393512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 11410120 - 11410173
Alignment:
| Q |
99 |
tttattatagcttttgttatagaaatagattatacat-agcacttatatgataa |
151 |
Q |
| |
|
||||||||| |||||| ||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
11410120 |
tttattatatcttttgatatagaaatagcttatagataagcacttatatgataa |
11410173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 99 - 136
Target Start/End: Original strand, 26522717 - 26522754
Alignment:
| Q |
99 |
tttattatagcttttgttatagaaatagattatacata |
136 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
26522717 |
tttattatatcttttgttatagaaatagtttatacata |
26522754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 291
Target Start/End: Complemental strand, 43173105 - 43173068
Alignment:
| Q |
254 |
ttgttatagttatactataagtgagatggctcacctga |
291 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
43173105 |
ttgttatagttatactatatgtaagatggctcacctga |
43173068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 5133752 - 5133712
Alignment:
| Q |
96 |
atctttattatagcttttgttatagaaatagattatacata |
136 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
5133752 |
atctttattttatcttttgttatagaaatagcttatacata |
5133712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000007; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 98 - 153
Target Start/End: Complemental strand, 14482180 - 14482124
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagc |
153 |
Q |
| |
|
||||||| || |||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
14482180 |
ctttattttatcttttgttatagaaatagtttatacataagcacttatatgataagc |
14482124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 98 - 153
Target Start/End: Original strand, 39392753 - 39392809
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacatag-cacttatatgataagc |
153 |
Q |
| |
|
||||||| || |||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
39392753 |
ctttattttatcttttgttatagaaatagtttatacatagccacttatatgataagc |
39392809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 153
Target Start/End: Original strand, 8536152 - 8536196
Alignment:
| Q |
110 |
ttttgttatagaaatagattatacat-agcacttatatgataagc |
153 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
8536152 |
ttttgttatagaaatagcttatacataagcacttatatgacaagc |
8536196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 98 - 153
Target Start/End: Complemental strand, 24975882 - 24975826
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagc |
153 |
Q |
| |
|
||||||| || |||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
24975882 |
ctttattttatcttttgttatagaagtagattatacatcagcacttatatgataagc |
24975826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 45078259 - 45078209
Alignment:
| Q |
110 |
ttttgttatagaaatagattatacata-gcacttatatgataagcgtttat |
159 |
Q |
| |
|
|||||||||| |||||| ||||||||| ||||||||||||||| ||||||| |
|
|
| T |
45078259 |
ttttgttataaaaatagcttatacataagcacttatatgataaacgtttat |
45078209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 135
Target Start/End: Complemental strand, 1418409 - 1418372
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat |
135 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
1418409 |
ctttattatatcttttgttatagaaataaattatacat |
1418372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 98 - 153
Target Start/End: Complemental strand, 5373203 - 5373147
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagc |
153 |
Q |
| |
|
||||||| || |||||||||||||||||| ||||||| |||||||| ||||||||| |
|
|
| T |
5373203 |
ctttattttatcttttgttatagaaatagcatatacataagcacttacatgataagc |
5373147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 160
Target Start/End: Original strand, 11721329 - 11721381
Alignment:
| Q |
109 |
cttttgttatagaaatagattatacatag-cacttatatgataagcgtttatt |
160 |
Q |
| |
|
|||||||||||||||||| ||||| | | ||||||||||||||||||||||| |
|
|
| T |
11721329 |
cttttgttatagaaatagtttataaagaaacacttatatgataagcgtttatt |
11721381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0590 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0590
Description:
Target: scaffold0590; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 159
Target Start/End: Original strand, 1166 - 1228
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagcgtttat |
159 |
Q |
| |
|
||||||| || |||||||||||||||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
1166 |
ctttattttatcttttgttatagaaatagcttatacataagcacttatatgatagacgtttat |
1228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 159
Target Start/End: Complemental strand, 2809 - 2747
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagcgtttat |
159 |
Q |
| |
|
||||||| || |||||||||||||||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
2809 |
ctttattttatcttttgttatagaaatagcttatacataagcacttatatgatagacgtttat |
2747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 152
Target Start/End: Original strand, 12407753 - 12407807
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacatagcacttatatgataag |
152 |
Q |
| |
|
||||||| || |||||||||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
12407753 |
ctttattttatcttttgttatagaaatagcttatacataacacttgtatgataag |
12407807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 99 - 159
Target Start/End: Complemental strand, 26516275 - 26516214
Alignment:
| Q |
99 |
tttattatagcttttgttatagaaatagattatacata-gcacttatatgataagcgtttat |
159 |
Q |
| |
|
|||||| || |||||||| ||||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
26516275 |
tttattttatcttttgttttagaaatagcttatacataagcacttatatgataagcgcttat |
26516214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 98 - 153
Target Start/End: Original strand, 20982227 - 20982283
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagc |
153 |
Q |
| |
|
||||||| || | |||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
20982227 |
ctttattttatcctttgttatagaaatagcttatacataagcacttatatgataagc |
20982283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 159
Target Start/End: Original strand, 37063166 - 37063228
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagcgtttat |
159 |
Q |
| |
|
||||||| || |||||||||||||||||| |||||||| |||| |||||||| |||| ||||| |
|
|
| T |
37063166 |
ctttattttatcttttgttatagaaatagtttatacataagcatttatatgacaagcatttat |
37063228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 99 - 151
Target Start/End: Complemental strand, 13224406 - 13224353
Alignment:
| Q |
99 |
tttattatagcttttgttatagaaatagattatacat-agcacttatatgataa |
151 |
Q |
| |
|
|||||| || |||||||||||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
13224406 |
tttattttatcttttgttatagaaatagcttatacataagcacttctatgataa |
13224353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 154
Target Start/End: Original strand, 35095875 - 35095932
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagcg |
154 |
Q |
| |
|
||||||| || |||||||||||||||||| ||| | || ||||||||||||||||||| |
|
|
| T |
35095875 |
ctttattttatcttttgttatagaaatagtttaaatataagcacttatatgataagcg |
35095932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 98 - 149
Target Start/End: Original strand, 7096219 - 7096271
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgat |
149 |
Q |
| |
|
||||||| || |||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
7096219 |
ctttattttatcttttgttatagaaatagcttatacataagcacttgtatgat |
7096271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 159
Target Start/End: Complemental strand, 10391329 - 10391269
Alignment:
| Q |
100 |
ttattatagcttttgttatagaaatagattatacata-gcacttatatgataagcgtttat |
159 |
Q |
| |
|
||||| || ||||||||||| |||||| |||||| || |||||||||||||||| |||||| |
|
|
| T |
10391329 |
ttattttatcttttgttataaaaatagcttatacgtaagcacttatatgataagtgtttat |
10391269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 153
Target Start/End: Complemental strand, 11684389 - 11684345
Alignment:
| Q |
110 |
ttttgttatagaaatagattatacat-agcacttatatgataagc |
153 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||||||||||||| |
|
|
| T |
11684389 |
ttttgttataaaaatagcttatacattagcacttatatgataagc |
11684345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 151
Target Start/End: Complemental strand, 36734871 - 36734817
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataa |
151 |
Q |
| |
|
||||||| || ||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
36734871 |
ctttattttaccttttgttatagaaagagattatacataagcacttatatgataa |
36734817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 98 - 154
Target Start/End: Complemental strand, 19422396 - 19422339
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagcg |
154 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
19422396 |
ctttattatatcttttgttatagaaataacttatacataagcatttatatgataagcg |
19422339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 109 - 151
Target Start/End: Complemental strand, 4191706 - 4191663
Alignment:
| Q |
109 |
cttttgttatagaaatagattatacat-agcacttatatgataa |
151 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
4191706 |
cttttgttatagaaatagcttatacataagcacttatatgataa |
4191663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 110 - 151
Target Start/End: Original strand, 2980575 - 2980617
Alignment:
| Q |
110 |
ttttgttatagaaatagattatacat-agcacttatatgataa |
151 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
2980575 |
ttttgttatagaaatagcttatacataagcacttatatgataa |
2980617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 98 - 157
Target Start/End: Complemental strand, 32724097 - 32724037
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagcgttt |
157 |
Q |
| |
|
||||||| || ||||||| |||||||||||||| |||| |||||| |||||| |||||||| |
|
|
| T |
32724097 |
ctttattttatcttttgtaatagaaatagattagacataagcactgatatgagaagcgttt |
32724037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 41050663 - 41050619
Alignment:
| Q |
109 |
cttttgttatagaaatagattataca-tagcacttatatgataag |
152 |
Q |
| |
|
|||||||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
41050663 |
cttttgttatagaaatagtttatacattaacacttatatgataag |
41050619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 148
Target Start/End: Complemental strand, 47970285 - 47970245
Alignment:
| Q |
109 |
cttttgttatagaaatagattatacat-agcacttatatga |
148 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
47970285 |
cttttgttatagaaatagcttatacataagcacttatatga |
47970245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 109 - 158
Target Start/End: Original strand, 41028954 - 41029004
Alignment:
| Q |
109 |
cttttgttatagaaatagattatacat-agcacttatatgataagcgttta |
158 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
41028954 |
cttttgttatagaaatagcttatacataagcacttatatgataagcattta |
41029004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 154
Target Start/End: Original strand, 34759631 - 34759675
Alignment:
| Q |
110 |
ttttgttatagaaatagattatacatagcacttatatgataagcg |
154 |
Q |
| |
|
||||| ||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
34759631 |
ttttgatatagaaatagcttatacataagacttatatgataagcg |
34759675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 98 - 153
Target Start/End: Original strand, 44374736 - 44374792
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacata-gcacttatatgataagc |
153 |
Q |
| |
|
||||||| || ||||||||| ||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
44374736 |
ctttattttatcttttgttaaagatatagcttatacataagcacttatatgataagc |
44374792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0654 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0654
Description:
Target: scaffold0654; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 110 - 152
Target Start/End: Original strand, 6741 - 6784
Alignment:
| Q |
110 |
ttttgttatagaaatagattatacat-agcacttatatgataag |
152 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
6741 |
ttttgttatagaaatagtttatacataagcacttatatgataag |
6784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 110 - 152
Target Start/End: Original strand, 116660 - 116703
Alignment:
| Q |
110 |
ttttgttatagaaatagattatacat-agcacttatatgataag |
152 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
116660 |
ttttgttatagaaatagtttatacataagcacttatatgataag |
116703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 159
Target Start/End: Complemental strand, 2514680 - 2514618
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacat-agcacttatatgataagcgtttat |
159 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||||||| |||||||| ||||||||| ||||| |
|
|
| T |
2514680 |
ctttattttatcttttattatagaaatagcttatacataagcacttacatgataagcatttat |
2514618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 110 - 151
Target Start/End: Original strand, 31668789 - 31668831
Alignment:
| Q |
110 |
ttttgttatagaaatagattatacat-agcacttatatgataa |
151 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
31668789 |
ttttgttatagaaatagcttatacataagcacttatatgataa |
31668831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 157
Target Start/End: Original strand, 3169348 - 3169397
Alignment:
| Q |
109 |
cttttgttatagaaatagattatacat-agcacttatatgataagcgttt |
157 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||||||||||||||||| |||| |
|
|
| T |
3169348 |
cttttgttatagaaataggttacacataagcacttatatgataagtgttt |
3169397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 110 - 158
Target Start/End: Complemental strand, 29249440 - 29249391
Alignment:
| Q |
110 |
ttttgttatagaaatagattatacata-gcacttatatgataagcgttta |
158 |
Q |
| |
|
||||||||||||||||| | ||||||| ||||||||||||||||| |||| |
|
|
| T |
29249440 |
ttttgttatagaaatagctgatacataagcacttatatgataagcattta |
29249391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 98 - 150
Target Start/End: Original strand, 29958002 - 29958054
Alignment:
| Q |
98 |
ctttattatagcttttgttatagaaatagattatacatagcacttatatgata |
150 |
Q |
| |
|
||||||| || ||||||||||| |||||| ||||||||||||||| |||||| |
|
|
| T |
29958002 |
ctttattttaccttttgttataaaaatagcatatacatagcacttagatgata |
29958054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 871012 - 870966
Alignment:
| Q |
109 |
cttttgttatagaaatagattatacat-agcacttatatgataagcg |
154 |
Q |
| |
|
||||||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
871012 |
cttttgttataaaaatagtttatacataagcacttatatgataagcg |
870966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 148
Target Start/End: Complemental strand, 13037831 - 13037791
Alignment:
| Q |
109 |
cttttgttatagaaatagattatacat-agcacttatatga |
148 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
13037831 |
cttttgttatagaaatagcttatacataagcacttatatga |
13037791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University