View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5873_high_12 (Length: 291)
Name: NF5873_high_12
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5873_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 17 - 281
Target Start/End: Complemental strand, 49139648 - 49139378
Alignment:
| Q |
17 |
attatggaggatgatgccgatgccgctgc------cgctgccgcgaataacaacaatagggtttcttcgtcaaatccttactggctggatgcctgtgaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49139648 |
attatggaggatgatgccgatgccgctgctgccgccgctgccgtgaataacaacaatagggtttcttcgtcaaatccttactggctggatgcctgtgaag |
49139549 |
T |
 |
| Q |
111 |
atatttctatatcttgtgatgatttcattgattttgatgtttctaatgattctgacnnnnnnnnnnnnnnnnnnnnnnnngacttttttggtggtattga |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49139548 |
atatttctatatcttgtgatgatatcattgattttgatgtttctaatgattctgaccaacaacccaacaacaacaaccaagacttttttggtggtattga |
49139449 |
T |
 |
| Q |
211 |
tcgaatctttgacagcatcaaaaacggcgctggtctccctgatcatcctcctgcttctgctgctgatgatg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49139448 |
tcgaatctttgacagcatcaaaaacggcgctggtctccctgatcatcctcctgcttctgctgctgatgatg |
49139378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University