View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5873_low_15 (Length: 238)

Name: NF5873_low_15
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5873_low_15
NF5873_low_15
[»] chr3 (1 HSPs)
chr3 (1-137)||(41056694-41056830)


Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 41056694 - 41056830
Alignment:
1 tttaaagtatggtaataattacattttaatttttgtttggatggattgaaattgatatagctttcagagcctctgactggaaaggtctggacattggaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41056694 tttaaagtatggtaataattacattttaatttttgtttggatggattgaaattgatatagctttcagagcctctgactggaaaggtctggacattggaag 41056793  T
101 attttgaggctcatccagctctattggtaggattctg 137  Q
    |||||||||||||||||||||||||||||||||||||    
41056794 attttgaggctcatccagctctattggtaggattctg 41056830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University