View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5873_low_16 (Length: 238)
Name: NF5873_low_16
Description: NF5873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5873_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 195667 - 195873
Alignment:
| Q |
18 |
atagtacagtaaatttttatactttagattttgactttggcaaccaatgtttattgtttattcaattcaacacatagtaaaaagtgcatatacgtttaaa |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195667 |
atagtacagtaaaattttatactttagattttgactttggcaaccaatgtttattgtttattcaattcaacacatagtaaaaagtgcatatacgtttaac |
195766 |
T |
 |
| Q |
118 |
caaatcacatgtaagtggcttcatttttctttctatctatcatgaaacttaaaatattctctaattatttttacattatgaaactcaaaataattaaaga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195767 |
gaaatcacatgtaagtggcttcatttttctttctatctatcatgaaacttaaaatattctctaattatttttacattatgaaactcaaaataattaaaga |
195866 |
T |
 |
| Q |
218 |
atcgacc |
224 |
Q |
| |
|
||||||| |
|
|
| T |
195867 |
atcgacc |
195873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University