View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5874-Insertion-7 (Length: 277)
Name: NF5874-Insertion-7
Description: NF5874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5874-Insertion-7 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 277
Target Start/End: Original strand, 41399995 - 41400270
Alignment:
| Q |
9 |
ggtgatgtcaagggtttggttagcgttccaccgctgtcgccgttgccttccttttgtttgtcacctttagttgttgtgtgaaatttctattttaaggttc |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41399995 |
ggtgatgtcaagggtttggtcagcgttccaccgctgtcgccgttaccttccttttgtttgtcacctttagttgttgtgtgaaatttctattctaaggttc |
41400094 |
T |
 |
| Q |
109 |
cttgcatcctgataaattagagatgtgaatttgtac-aattcatgaaatgatttcatttattcactaaatgtttctttggatatacttgactatttta-- |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41400095 |
cttgcatcctgataaattagagatgtgaatttgtacaaattcatgaaatgatttcatttattcactaaatgtttctttggatatacttgactattttata |
41400194 |
T |
 |
| Q |
206 |
----tatttttagattgctagtatagaaaaagagttgagacaaagagtttaaattctaaataaaattgttaggatg |
277 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41400195 |
tttttatttttagattgctagtatcgaaaaagagttgagacaaagagtttaaattctaaataaaattgttaggatg |
41400270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 30 - 102
Target Start/End: Original strand, 41407126 - 41407198
Alignment:
| Q |
30 |
agcgttccaccgctgtcgccgttgccttccttttgtttgtcacctttagttgttgtgtgaaatttctatttta |
102 |
Q |
| |
|
|||||| ||||| |||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41407126 |
agcgtttcaccgttgtctccgttatcttccttctgtttgtcacctttagttgttgtgtgaaatttctatttta |
41407198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University