View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5875_high_34 (Length: 248)
Name: NF5875_high_34
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5875_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 198
Target Start/End: Original strand, 17998902 - 17998932
Alignment:
| Q |
168 |
cacaaaatctcacatgttttctaaagtgtac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17998902 |
cacaaaatctcacatgttttctaaagtgtac |
17998932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University