View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5875_high_39 (Length: 241)
Name: NF5875_high_39
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5875_high_39 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 11 - 241
Target Start/End: Complemental strand, 26599515 - 26599285
Alignment:
| Q |
11 |
ccatcatcagacgacgccgtatcgatttcaaagtcagttgagttagtagtgagactgaggctatgatcattgtgagggttttggctattacttgtttgtt |
110 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26599515 |
ccatcatcagacgacgacgtatcgatttcaaagtcagttgagttagtagtgagactgaggctatgatcattgtgagggttttggctattacttgtttgtt |
26599416 |
T |
 |
| Q |
111 |
ggaaatggaaattattgttgttgacaaaattggtttctggtagagaagtttggttactgttttcaccatataaagcttcaagttgacgaaaaaacctgta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26599415 |
ggaaatggaaattattgttgttgacaaaattggtttctggtagagaagtttggttactgttttcaccatataaagcttcaagttgacgaaaaaacctgta |
26599316 |
T |
 |
| Q |
211 |
atgcttaccctcatgccttcctgctttacct |
241 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
26599315 |
atgcttaccatcatgccttcctgctttacct |
26599285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University