View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5875_low_35 (Length: 248)

Name: NF5875_low_35
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5875_low_35
NF5875_low_35
[»] chr5 (1 HSPs)
chr5 (168-198)||(17998902-17998932)


Alignment Details
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 198
Target Start/End: Original strand, 17998902 - 17998932
Alignment:
168 cacaaaatctcacatgttttctaaagtgtac 198  Q
    |||||||||||||||||||||||||||||||    
17998902 cacaaaatctcacatgttttctaaagtgtac 17998932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University