View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5875_low_46 (Length: 227)
Name: NF5875_low_46
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5875_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 2 - 210
Target Start/End: Original strand, 29103890 - 29104098
Alignment:
| Q |
2 |
tcaggtggatatagcactagagtgtgcaaggatgcatcataggttttctttgcctcccttggaggtggaagatttccctcaagttggtatgaattctgag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103890 |
tcaggtggatatagcactagagtgtgcaaggatgcaacataggttttctttgcctcccttggaggtggaagatttccctcaagttggtatgaattctgag |
29103989 |
T |
 |
| Q |
102 |
ctgaagatgacacaattagtctcaggttccatgagtggaactagaaatgaaacagatatcttgcaggaaattctatctgtagctcaagcttctcaagaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103990 |
ctgaagatgacacaattagtctcaggttccatgagtggaactagaaatgaaacagatatcttgcaggaaattctatctgtagctcaagcttctcaagaat |
29104089 |
T |
 |
| Q |
202 |
tgataaacc |
210 |
Q |
| |
|
||||||||| |
|
|
| T |
29104090 |
tgataaacc |
29104098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 3 - 88
Target Start/End: Complemental strand, 32788340 - 32788255
Alignment:
| Q |
3 |
caggtggatatagcactagagtgtgcaaggatgcatcataggttttctttgcctcccttggaggtggaagatttccctcaagttgg |
88 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||| || ||||||| ||||||||||| || || ||||||||||| |
|
|
| T |
32788340 |
caggtggatattgcactagagtgtgcaaggatgcaacataggtttgctatgcctccattggaggtggaggaatttcctcaagttgg |
32788255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 6 - 55
Target Start/End: Original strand, 36149534 - 36149583
Alignment:
| Q |
6 |
gtggatatagcactagagtgtgcaaggatgcatcataggttttctttgcc |
55 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36149534 |
gtggatattgcactagagtgtgcaaggatgcatcataggttttctatgcc |
36149583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University