View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5875_low_5 (Length: 475)
Name: NF5875_low_5
Description: NF5875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5875_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 447; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 447; E-Value: 0
Query Start/End: Original strand, 5 - 459
Target Start/End: Complemental strand, 35294662 - 35294208
Alignment:
| Q |
5 |
gaggagcagagaagaagctagggtttcgttatgcacgccgcggattttatcggcgattcgttcgttgattgattcgcgttacgttgttgttcaggtcaac |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294662 |
gaggaacagagaagaagctagggtttcgttatgcacgccgcggattttatcgtcgattcgttcgttgattgattcgcgttacgttgttgttcaggtcaac |
35294563 |
T |
 |
| Q |
105 |
gctgttgcttcgttggtcaacctttcgttggagaaatcgaacaagatgagaattgtgcggtcaggatttgttccttttctgattgatgtgttgaaagggg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294562 |
gctgttgcttcgttggtcaacctttcgttggagaaatcgaacaagatgagaattgtgcggtcaggatttgttccttttctgattgatgtgttgaaagggg |
35294463 |
T |
 |
| Q |
205 |
ggttcagtgaatcgcaggaacatgctgcgggtgcgttgtttagtttggctttggatgatgataataagatggcaattggtgttcttggtgctttgcagcc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294462 |
ggttcagtgaatcgcaggaacatgctgcgggtgcgttgtttagtttggctttggatgatgataataagatggcaattggtgttcttggtgctttgcagcc |
35294363 |
T |
 |
| Q |
305 |
gttgatgcacgcgctgaggtcggagtctgagcgaacgaggcatgattcagcgcttgcgctgtatcatttaacgctggttcagagtaatagagttaagatg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294362 |
gttgatgcacgcgctgaggtcggagtctgagcgaacgaggcatgattcagcgcttgcgctgtatcatttaacgctggttcagagtaatagagttaagatg |
35294263 |
T |
 |
| Q |
405 |
gttaaacttggggtggttccgacgttgctttcgatggtgatgaccgggacaatgg |
459 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294262 |
gttaaacttggggtggttccgacgttgctttcgatggtgatgaccgggacaatgg |
35294208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 211 - 296
Target Start/End: Complemental strand, 2222149 - 2222064
Alignment:
| Q |
211 |
gtgaatcgcaggaacatgctgcgggtgcgttgtttagtttggctttggatgatgataataagatggcaattggtgttcttggtgct |
296 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||||||||| || | |||||||||||||| | || ||||||||| | |||||| |
|
|
| T |
2222149 |
gtgaatcgcaggaacatgcttcgtgtgcgatgtttagtttagcgcttgatgatgataataaaactgcgattggtgttttaggtgct |
2222064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University