View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876-Insertion-14 (Length: 201)
Name: NF5876-Insertion-14
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876-Insertion-14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 201
Target Start/End: Original strand, 29079454 - 29079644
Alignment:
| Q |
11 |
taacacataaaaaatgaaatcaaatttctatcaaccctttataatattgtgtcattctattgtaacctttcataagagaaagagacaaaatccacatgag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29079454 |
taacacataaaaaatgaaatcaaatttctatcaaccctttataatattgtgtcattctattgtaacctttcataagagaaagagacaaaatccacatgag |
29079553 |
T |
|
| Q |
111 |
cagtaatagtgttgaatgataaaaatataacttctagaaataaacaatgaatgacaaaatgatatatttatgtataatttatagtatctta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29079554 |
cagtaatagtgttgaatgataaaaatataacttctagaaataaacaatgaatgacaaaatgatatatttatgtataatttatagtatctta |
29079644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University