View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876-Insertion-20 (Length: 122)
Name: NF5876-Insertion-20
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876-Insertion-20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 9 - 122
Target Start/End: Complemental strand, 43394408 - 43394295
Alignment:
| Q |
9 |
aaaacatggacatctttgaacattttgaaaatattctttttctggtatatgtttgttttaccaacaaatttacttttgatggccccttccaatatgctat |
108 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43394408 |
aaaatatggacatctttaaacattttgaaaatattcttttttcggtttatgtttgttttatcaacaaatttacttttgatggccccttccaatatgctat |
43394309 |
T |
 |
| Q |
109 |
aacgattaatacta |
122 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43394308 |
aacgattaatacta |
43394295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University