View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876-Insertion-23 (Length: 64)
Name: NF5876-Insertion-23
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876-Insertion-23 |
 |  |
|
| [»] scaffold0224 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0224 (Bit Score: 52; Significance: 1e-21; HSPs: 1)
Name: scaffold0224
Description:
Target: scaffold0224; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 9 - 64
Target Start/End: Original strand, 13945 - 14000
Alignment:
| Q |
9 |
agattgaagctgatttccccagatacaacctcgtgacccttttaatcatgtctagt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13945 |
agattgaagctgatttccccagatacaacttcgtgacccttttaatcatgtctagt |
14000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 1e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 9 - 64
Target Start/End: Complemental strand, 42932826 - 42932771
Alignment:
| Q |
9 |
agattgaagctgatttccccagatacaacctcgtgacccttttaatcatgtctagt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42932826 |
agattgaagctgatttccccagatacaacttcgtgacccttttaatcatgtctagt |
42932771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University