View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_high_36 (Length: 331)
Name: NF5876_high_36
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_high_36 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 26 - 331
Target Start/End: Complemental strand, 14272969 - 14272664
Alignment:
| Q |
26 |
gcaccaaactctcttccttcttgtgcaacattcatggacgactcaacacagccactgctcacacccaaaccaaaagaacaacgccatggaatcaacacaa |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14272969 |
gcaccaaactctcttccttcttgtgcaacattcatggacgactcaacacagccactgctcacacctaaaccaaaagaacaacgccatggaatcaacacaa |
14272870 |
T |
 |
| Q |
126 |
aatttccctcaccaccatctaacactgcaatattcacggctgcagcccccgacatggacttgatcacaagccccaaagacttcttcaaacaattcatcgt |
225 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14272869 |
actttccctcaccaccatctaacaccgcaatattcacggctgcagcccccgacatggacttgatcacaagccccaaagacttcttcaaacaattcatcgt |
14272770 |
T |
 |
| Q |
226 |
tgagtcgaagaagctgtggtaccttgctgggcctgccatcttctccttcgtctccaaatattcccttggagctgtcactcaaatcttcgccggtcatgtt |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14272769 |
tgagtcgaagaagctgtggtaccttgctgggcctgccatcttctccttcgtctccaaatattcccttggagctgtcactcaaatcttcgccggtcatgtt |
14272670 |
T |
 |
| Q |
326 |
agtacc |
331 |
Q |
| |
|
|||||| |
|
|
| T |
14272669 |
agtacc |
14272664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University