View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5876_high_44 (Length: 296)

Name: NF5876_high_44
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5876_high_44
NF5876_high_44
[»] chr2 (1 HSPs)
chr2 (51-276)||(15198036-15198261)


Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 51 - 276
Target Start/End: Original strand, 15198036 - 15198261
Alignment:
51 tggtatttttggattgacttgcctgaattaccagaaccaacaacaaggatagattggttcttgggaacatagagattgatgataggagacaaagtaatat 150  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
15198036 tggtatttttggattgacttgcctgaattaccagaaccaacaacaaggatagattggttcttgggaacatagagattgatgataggagccaaagtaatat 15198135  T
151 acttttggtaccaatcaaaaggaccaggttcgtttgtgtaacggttgtcccagtaccatgattcaccgtatgcttgtgtccctgttgccatcactgtttc 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
15198136 acttttggtaccaatcaaaaggaccaggttcgtttgtgtaacggttgtcccagtaccatgattcaccgtatgcttgtgtacctgttgccatcactgtttc 15198235  T
251 gatcttcaaaatatgttgtttggaac 276  Q
    ||||||||||||||||||||||||||    
15198236 gatcttcaaaatatgttgtttggaac 15198261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University