View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_high_77 (Length: 242)
Name: NF5876_high_77
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_high_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 41198661 - 41198436
Alignment:
| Q |
1 |
taaaatagatatgaaaattgaaaaccaacacattcatcatagcaaacaatgattcatcagcaaaaaatcaaatatcaggcatgaaaagtttagcaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41198661 |
taaaatagatatgaaaattgaaaaccaacacattcatcatagcaaacaatgattcatcagcaaaaaatcaaatatcaggcatgaaaagtttagcaattat |
41198562 |
T |
|
| Q |
101 |
ataaattgaatacagtgatgatgaaattcataccatttatcttctttgagaattcatcccaccaatctacaacaccctctttctcagatgacccagaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41198561 |
ataaattgaatacagtgatgatgaaattcataccatttatcttctttgagaattcatcccaccaatctacaacaccctctttctcagatgacccagaagc |
41198462 |
T |
|
| Q |
201 |
agaatcattattattgtcataactct |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41198461 |
agaatcattattattgtcataactct |
41198436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 130 - 204
Target Start/End: Complemental strand, 41208515 - 41208441
Alignment:
| Q |
130 |
ataccatttatcttctttgagaattcatcccaccaatctacaacaccctctttctcagatgacccagaagcagaa |
204 |
Q |
| |
|
||||| || ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41208515 |
ataccgttgatcttctttgacaattcatcccaccaatctacaagaccctctttctcagatgacccagaagcagaa |
41208441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 41208588 - 41208525
Alignment:
| Q |
1 |
taaaatagatatgaaaattgaaaaccaacacattcatcatagcaaacaatgattcatcagcaaaa |
65 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
41208588 |
taaaatagatatgaaa-ttgaaaaccaacacattcatcatagcaaacaatgatgcatcaacaaaa |
41208525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University