View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_high_78 (Length: 242)
Name: NF5876_high_78
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_high_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 15184024 - 15183803
Alignment:
| Q |
1 |
attcgatagagtatgagacataggaggatacataaattagtggagcaaggacatgggatattaattattgcttacttggtattccactttctttgtctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15184024 |
attcgatagagtatgagacataggaggatacataaattagtggagcaaggacatgggatattaattattgcttacttggtattccactttctttgtctat |
15183925 |
T |
 |
| Q |
101 |
gcacttcaaaggagtgtaaaaagcacgtgtattttgtctactttgcactctttccnnnnnnnatgttggtgatattcttcagcttatggatatgtaccag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15183924 |
gcacttcaaaggagtgtaaaaagcacgtgtattttgtctactttgcactctttcc---ttttatgttggtgatattcttcagcttatggatatgtaccag |
15183828 |
T |
 |
| Q |
201 |
gactcatttctcattcaagttcaaa |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
15183827 |
gactcatttctcattcaagttcaaa |
15183803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University