View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_low_45 (Length: 296)
Name: NF5876_low_45
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 51 - 276
Target Start/End: Original strand, 15198036 - 15198261
Alignment:
| Q |
51 |
tggtatttttggattgacttgcctgaattaccagaaccaacaacaaggatagattggttcttgggaacatagagattgatgataggagacaaagtaatat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15198036 |
tggtatttttggattgacttgcctgaattaccagaaccaacaacaaggatagattggttcttgggaacatagagattgatgataggagccaaagtaatat |
15198135 |
T |
 |
| Q |
151 |
acttttggtaccaatcaaaaggaccaggttcgtttgtgtaacggttgtcccagtaccatgattcaccgtatgcttgtgtccctgttgccatcactgtttc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15198136 |
acttttggtaccaatcaaaaggaccaggttcgtttgtgtaacggttgtcccagtaccatgattcaccgtatgcttgtgtacctgttgccatcactgtttc |
15198235 |
T |
 |
| Q |
251 |
gatcttcaaaatatgttgtttggaac |
276 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
15198236 |
gatcttcaaaatatgttgtttggaac |
15198261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University