View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_low_55 (Length: 258)
Name: NF5876_low_55
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 242
Target Start/End: Complemental strand, 43688567 - 43688341
Alignment:
| Q |
16 |
cctgtggagaaaattgatattatccactaaccttcagatgctaaagtagctagacatgcatctgatagcccaagctgtttcaaacttaaagattcatcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43688567 |
cctgtggagaaaattgatattatccactaaccttcagatgctaaagtagctagacatgcatctgatagcccaagctgtttcaaacttaaagattcatcaa |
43688468 |
T |
|
| Q |
116 |
ttctaaagagaatcaaggacataaccagcttttcaagaaccataaccaatcaaacgagtcaatgtaatttaacagttaatcttttccaaagctataacgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43688467 |
ttctaaagagaatcaaggacataaccagcttttcaagaaccataaccaatcaaacgagtcaatgtaatttaacagttaatcttttccaaagctataacgc |
43688368 |
T |
|
| Q |
216 |
agtttccagggaaaactacaaagctat |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43688367 |
agtttccagggaaaactacaaagctat |
43688341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University