View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_low_70 (Length: 250)
Name: NF5876_low_70
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_low_70 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 55072821 - 55072577
Alignment:
| Q |
14 |
agaagagagatgccagtgagcttggttcccaccaccaacatgtccttagtccttacacacacacaacccaaaacacccgtgggctctcctttgcaatttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55072821 |
agaagagagatgccagtgagcttggttcccaccaccaacatgtccttagtccttacacacacacaacccaaaacacccgtgggctctcctttgcaatttc |
55072722 |
T |
 |
| Q |
114 |
ttgtccccacactccacatgaacaactgaaa--------ccnnnnnnnnnnnntcattgcttcttcataaataaataccaaccgtcacacccattataac |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55072721 |
ttgtccccacaatccacatgaacaactgaaaccctctttccctctctctctcttcattgcttcttcataaataaataccaaccgtcacacccattataac |
55072622 |
T |
 |
| Q |
206 |
ttcaaccatcctcagtcctcaccactataatagtactaggtctct |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55072621 |
ttccaccatcctcagtcctcaccactataatagtactaggtctct |
55072577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University