View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_low_74 (Length: 248)
Name: NF5876_low_74
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_low_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 13287497 - 13287736
Alignment:
| Q |
1 |
cgtatccgtgctgtcataggtagtaagtaataggaacttgacctttttcatgcgaactccttggaggctaagctccagttgactctctaggtcttgtagg |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
13287497 |
cgtatccgtgctttcataggtagtaagtaataggaacttgacctttttcatgcgaactccttgtaggctaagttccagctgactctctaggtcttgtagg |
13287596 |
T |
|
| Q |
101 |
tttctgatactcaaaccataaagctgttctcccatcaactgcctatgagctcaaaatgttagtgttctcatacatggagcttaatgaatagaaatattg- |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
13287597 |
tttctgatactcaaaccataaagctgttctcccatcaattgcctatgagctcaaaatgttagtgctctcatacaaggagcttaatgaatagaaatattga |
13287696 |
T |
|
| Q |
200 |
-aaaaaatgctgaatgaattagttgaaggttgtacctatg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13287697 |
aaaaaaatgctgaatgaattagttgaaggttttacctatg |
13287736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University